90
|
MetaMorph Inc
real-time video recordings using metamorph 3.0 Real Time Video Recordings Using Metamorph 3.0, supplied by MetaMorph Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/real-time+video+recordings+using+metamorph+3%2E0/image+processing+software+metamorph+3+7/pm10491266-172-8-8 Average 90 stars, based on 1 article reviews
real-time video recordings using metamorph 3.0 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
universal imaging inc
matrox image lc frame grabber Matrox Image Lc Frame Grabber, supplied by universal imaging inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/real-time+video+recordings+using+metamorph+3%2E0/matrox+card/pm10777573-91-22-32 Average 90 stars, based on 1 article reviews
matrox image lc frame grabber - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
MetaMorph Inc
metamorph software Metamorph Software, supplied by MetaMorph Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/real-time+video+recordings+using+metamorph+3%2E0/metamorph+software/pm15507212-214-38-64 Average 90 stars, based on 1 article reviews
metamorph software - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Sony
9500 vcr 9500 Vcr, supplied by Sony, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/real-time+video+recordings+using+metamorph+3%2E0/9500+vcr/pm10037753-102-24-23 Average 90 stars, based on 1 article reviews
9500 vcr - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
99
|
Oxford Instruments
imaris bitplane Imaris Bitplane, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/real-time+video+recordings+using+metamorph+3%2E0/Imaris/pm32610125-346-182-182 Average 99 stars, based on 1 article reviews
imaris bitplane - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
86
|
Jackson Laboratory
b6cba B6cba, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/real-time+video+recordings+using+metamorph+3%2E0/3707bres+apoc3+cba+j+tg/pm36044851-211-107-108 Average 86 stars, based on 1 article reviews
b6cba - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
86
|
Jackson Laboratory
mouse Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/real-time+video+recordings+using+metamorph+3%2E0/mouse/pm32931754-221-12-14 Average 86 stars, based on 1 article reviews
mouse - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
86
|
Jackson Laboratory
resource source identifier mouse Resource Source Identifier Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/real-time+video+recordings+using+metamorph+3%2E0/identifier+mouse+resource+source/pm32931754-221-2-7 Average 86 stars, based on 1 article reviews
resource source identifier mouse - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
86
|
Jackson Laboratory
b6 cg B6 Cg, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/real-time+video+recordings+using+metamorph+3%2E0/26sortm14+b6+cag+cg+gt+hze+j+rosa+tdtomato/pm32931754-221-27-28 Average 86 stars, based on 1 article reviews
b6 cg - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
93
|
OriGene
cattgaccgctacctgaagacc origene Cattgaccgctacctgaagacc Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/real-time+video+recordings+using+metamorph+3%2E0/P2ry12+Mouse+qPCR+Primer+Pair/pm32931754-221-112-113 Average 93 stars, based on 1 article reviews
cattgaccgctacctgaagacc origene - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
94
|
OriGene
ctgtggtcatgag cccttc origene Ctgtggtcatgag Cccttc Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/real-time+video+recordings+using+metamorph+3%2E0/Gapdh+Mouse+qPCR+Primer+Pair/pm32931754-221-69-71 Average 94 stars, based on 1 article reviews
ctgtggtcatgag cccttc origene - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
90
|
OriGene
agaaggcagtcgtgagcttgca origene Agaaggcagtcgtgagcttgca Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/real-time+video+recordings+using+metamorph+3%2E0/Cx3cr1+Mouse+qPCR+Primer+Pair/pm32931754-221-104-105 Average 90 stars, based on 1 article reviews
agaaggcagtcgtgagcttgca origene - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |